Sequence Any Section Of Our Plasmids Using 20 Standardised Primers

 

  • All of our plasmids have the same backbone and we insert DNA components into specific restriction site locations
  • The primers below will help you to sequence inserts made into any resitrction site
  • There are 10 forward primers and 10 reverse primers
  • All primers will bind all of our plasmids with the exception of R3 in peptide tag plasmids and also our virus vectors

 

Where possible, the binding sites for each of these primers have been conserved. Each primer has been designed to the following parameters:

GC content: 50-55 % 
Melting point (TM): 55-60°C
Base Pairs (BP): 18-22 nucleotides
Primer dimer: No
2ndry structure: None-Weak
 

 Sequencing inserts in the Bgl2 site: 

Forward BglII (primer binds between AsiSI and Bgl2 and reads towards Bgl2)
Primer name: OGP-F1  
Sequence: TCGTTGCGTTACACACAC
TM: 59°C
BP: 18
GC: 50%
Dimer: No
2ndry structure: None

 

Reverse Bgl II (primer binds between NotI and Bgl2 and reads towards Bgl2)
Primer name: OGP-R1
Sequence: TGTGTCGAGTGGATGGTAG
TM: 59.67°C
BP: 19
GC: 52.6%
Dimer: No
2ndry structure: None

back to top

 

Sequencing inserts between NotI – XbaI (sequences the MCS):

Forward NotI-XbaI (primer binds between BglII and NotI and reads towards NotI)
Primer name: OGP-F2
Sequence: TGTCGATCCTACCATCCA
TM: 60°C
BP: 18
GC: 50%
Dimer: No
2ndry structure: Very weak

 

Reverse XbaI-NotI (primer binds between CIaI and XbaI and reads towards XbaI, however, the 3' of genes that end at the XbaI may be missed by this primer and using OGP-R3 may provide better resolution of the end of your gene)
Primer name: OGP-R2
Sequence: AGTCAGTCAGTGCAGGAG
TM: 56°C
BP: 18
GC: 55%
Dimer: No
2ndry structure: None

back to top 

 

 

Sequencing inserts between ClaI – NheI (sequences the fusion MCS):

 

Forward ClaI-NheI (primer binds between XbaI and BsgI and reads towards BsgI)
Primer name: OGP-F3
Sequence: AGTTGTCTCCTCCTGCACT
TM: 58.97°C
BP: 19
GC: 53%
Dimer: No
2ndry structure: Very weak

 

Reverse NheI-ClaI (primer binds between SbfI and NheI and reads towards NheI)
Primer name: OGP-R3
Sequence: AGCTGAAGGTACGCTGTATC
TM: 58.53°C
BP: 20
GC: 50%
Dimer: No
2ndry structure: Weak

back to top

 

 

Sequencing inserts in the SbfI site:

 

Forward SbfI (primer binds between NheI and SbfI and reads towards SbfI). These primer sequences were changed in January 2014 because in some plasmids low level homology was causing mixed reads.
Primer name: OGP-F4
Sequence: GGATTGCTATCTACCGG
TM: 55°C
BP: 17
GC: 53%
Dimer: No
2ndry structure: None

 

Reverse SbfI (primer binds between PacI and SbfI and reads towards SbfI)
Primer name: OGP-R4
Sequence: CCAAGGTAACCAATGAG
TM: 53°C
BP: 17
GC: 47%
Dimer: No
2ndry structure: None

back to top

 

 

Sequencing inserts in the PacI site:

Forward PacI (primer binds between SbfI and PacI and reads towards PacI)
Primer name: OGP-F5
Sequence: CTCATTGGTTACCTTGGG
TM: 57.8°C
BP: 18
GC: 50%
Dimer: No
2ndry structure: None

 

Reverse PacI (primer binds between SwaI and PacI and reads towards PacI)
Primer name: OGP-R5
Sequence: ACAAGTCGATCTCGCCAA
TM: 62°C
BP: 18
GC: 50%
Dimer: No
2ndry structure: None

back to top

 

 

Sequencing inserts in the SwaI site:

Forward SwaI (primer binds between PacI and SwaI and reads towards SwaI)
Primer name: OGP-F6
Sequence: TGGTCCTTGCTATTGCAC
TM: 59.79°C
BP: 18
GC: 50%
Dimer: No
2ndry structure: Weak

 

Reverse SwaI (primer binds between FseI and SwaI and reads towards SwaI)
Primer name: OGP-R6
Sequence: CAAGATGGATCGGACGAA
TM: 62°C
BP: 18
GC: 50%
Dimer: No
2ndry structure: None

back to top

 

 

Sequencing inserts in the FseI site:

Forward FseI (primer binds between SwaI and FseI and reads towards FseI)
Primer name: OGP-F7
Sequence: GATCCATCTTGCAGGCTAC
TM: 59.78°C
BP: 19
GC: 53%
Dimer: No
2ndry structure: None

 

Reverse FseI (primer binds between AscI and FseI and reads towards FseI)
Primer name: OGP-R7
Sequence: GGAGTAATACCTGGCGATAG
TM: 57.7°C
BP: 20
GC: 50%
Dimer: No
2ndry structure: None

back to top

 

  

Sequencing inserts in the AscI site:

Forward AscI (primer binds between FseI and AscI and reads towards AscI)
Primer name: OGP-F8
Sequence: TCCCGATCTATCCGAGAT
TM: 59.51°C
BP: 18
GC: 50%
Dimer: No
2ndry structure: Weak

 

Reverse AscI (primer binds between PmeI and AscI and reads towards AscI)
Primer name: OGP-R8
Sequence: ATCGTCGAGACTCGCAC
TM: 61.24°C
BP: 18
GC: 55%
Dimer: No
2ndry structure: Weak

back to top

 

 

Sequencing inserts in the PmeI site:

Forward PmeI (primer binds between AscI and PmeI and reads towards PmeI)
Primer name: OGP-F9
Sequence: CAGGAAGTCCAATCGTCAG
TM: 60.85°C
BP: 19
GC: 53%
Dimer: No
2ndry structure: None

 

Reverse PmeI (primer binds between AsiSI and PmeI and reads towards PmeI)
Primer name: OGP-R9
Sequence: CTCGAAACGACGGAGATT
TM: 60.3°C
BP: 18
GC: 50%
Dimer: No
2ndry structure: Weak

back to top

 

 Sequencing inserts in the AsiSI site:

Forward AsiSI (primer binds between PmeI and AsiSI and reads towards AsiSI)
Primer name: OGP-F10
Sequence: GAATCTCGTCAGCTATCGTC
TM: 58.97°C
BP: 20
GC: 50%
Dimer: No
2ndry structure: None

 

Reverse AsiSI (primer binds between BglII and AsiSI and reads towards AsiSI)
Primer name: OGP-R10
Sequence: CCTGTGGAGCTAATGGTC
TM: 58°C
BP: 18
GC: 55%
Dimer: No
2ndry structure: None

back to top