Human IgG Vector Set (PP2409)

Product Code:
$553.71
1

Product Description

This pack enables you to engineer monoclonal expression of your chosen human antibody. The plasmids encode the constant regions of human IgG1 heavy chain and of both lambda and kappa light chains, providing a framework for you to insert the variable regions of your choice.

The Human IgG vector set offers the ability to simply and quickly clone in your variable regions and begin your screening immediately. The Human IgG vector set contains pSF-CMV-HuIgG1 HC (OG527), pSF-CMV-HuKappa LC (OG528) and pSF-CMV-HuLambda LC (OG529). Oxford Genetics recommends the use of HEK293 or CHO cells for expression. Also view our Mouse and Rat IgG vector sets.  

Cloning Advice (OG527)

Oxford Genetics recommend the use of NcoI/BseRI restriction to insert your variable regions (CDR, secretory signal peptide sequences).

 

3’ Cut Site

The BseRI restriction enzyme site upstream of the constant domain is cleaved downstream of its recognition site produces a 3’ overhang which includes first two bases of the first codon of the constant region. A corresponding BseRI is a Type IIS restriction enzyme, which recognises non-palindromic sequences and cuts outside of its recognition sequence. A reverse PCR primer must include a BseRI site in the reverse orientation and with a suitable spacer which includes two bases which are complimentary to the 3’ overhang. The following adapter can be appended to the 3’ of the intended variable region: GGNNNNNNNNCTCCTC (BseRI in bold).

5’ Cut Site

NcoI cuts leaving a 4-base 5’ overhang complimentary to the last base of the KOZAK sequence and to the three bases of the initiator ATG. However, to encode an NcoI site, a second guanine residue is included downstream of the ATG, as seen here in bold: CCATGG. When designing a 5’ PCR primer against the 5’ terminus of the secretory signal peptide allowance must be made for the presence of this guanine residue in the restriction site.  Consequently, the first amino acid of the signal peptide will need to be encoded by a codon in which the first residues is a guanine, thus limiting the choice of first encoded amino acid downstream of the initiator to the following: val, ala, asp, glu or gly.

Recommended secretory signal peptides

Heavy chain signal peptide

Peptide sequence: MDWTWRFLFVVAAATGVQS

DNA sequence: atggactggacgtggcgctttctcttcgtcgtcgccgctgccactggagtccagtcg

 

Light signal chain signal peptide

Peptide sequence: MDMRVPAQLLGLLLLWLSGARC

DNA sequence: atggacatgagagtgccggcccagctgctgggactcctgctcctgtggctgagcggcgcaaggtgc